 [--------------------------------------------------------------------------]
   ooooo   ooooo  .oooooo.  oooooooooooo       HOE E'ZINE RELEASE #580
   `888'   `888' d8P'  `Y8b `888'     `8
    888     888 888      888 888              "DNA, The Perfect Template
    888ooooo888 888      888 888oooo8               for a Metaphor"
    888     888 888      888 888    "
    888     888 `88b    d88' 888       o         by Anilos [4/14/99]
   o888o   o888o `Y8bood8P' o888ooooood8
 [--------------------------------------------------------------------------]

	Over my spring break I learned a lot of different things, but more
 important of all is the epiphany I had one night in the vector of
 inspiration for me, the garage.  I'm fairly certain now that Molecular
 Biology can be a metaphor for just about anything in life, allow me to
 elucdicate... DNA, the little molecule that is the blueprints for our
 entire body is essentially a message, a story, if you will.  Before I
 continue I just would like to apologize to the people reading this and not
 understanding a damn thing, I just feel I should write about this since I
 find it fascinating.  There is a lot about DNA that would take up pages and
 pages of explanation, but I'm trying to appeal to all people here so I'll
 try to make it short and simple.

        DNA is two nucleotides wound together in the double helix I'm sure
 everyone has heard at least once (i.e. Those who have seen Jurassic park,
 more than likely).  The "rungs" on the DNA "Ladder" are essentially
 nitrogen bases We won't refer to them by their technical names and instead
 as A,T,G, and C.  Now then, In DNA the A's must pair with a T and the G's
 must pair with a C and vice versa (T to A and C to G). If your still with
 me, pat yourself on the back, I don't plan on putting in any references to
 sex, gatorade or rage (which is going to be really hard for me).  So, if
 your looking for any of the aforementioned, just stop.  I'm sitting in my
 garage now and I was thinking about the days lesson in Molecular biology...
 Mutations.  I began to think, "Hmm, now, mutations can be beneficial or
 harmful.  And DNA itself is a message which might very well decide
 important aspects of our lives, therefore we can use DNA as a metaphor for
 life!  Yes!  This will probably bore some people, but goddamnit, I don't
 care."

        Let's write out a basic DNA 'Message':

        (I'm going to use an acquaintence's name as an example, and because
 it's already written down on paper and I don't want to use mine, it would
 take too long.)

        ACATTGTTTTTTGATCGGTTCTGGTTATTCTAGTAGGATCGCCCGTTTTTGCCACCA

        - Now, believe it or not, this in fact actually spells out my
          acquaintence's name "Matt Eric Biggerstaff" (The translation of
          the message isn't important nor relevant to the point of this, but
          hell, if your interested anyways just e-mail me).  Basically, this
          is a normal, happy little piece of DNA.  Mutations, though can
          screw the message up, so we can assume, that if life was a DNA
          strand, mutations could screw up someone's life.  Let us look at
          some common mutations and practical applications to this
          metaphorical look at DNA:

        - Substitution:  This is where one of the four letters (A,T,C, and
          G) are mispaired (ie. A to G or T to C).

          An example for life:  Instead of your real dad, your mom
          re-marries and substitutes a step-dad, potentiality for a screw
          up/misreading of the DNA.

        - Insertion:  DNA is read in tripletts (GAT, TTT, etc.) but with
          insertion you end up with sequences such as, GATA, TTT, etc.

          Another example for life:  I began to date a very odd girl that
          only made my life miserable, essentially she was "inserted" into
          my life (I know some of you are giggling at the word 'insert').

        - Deletion:  When being read in tripletts, this is when a A,C,G or
          T is missing (i.e. the small message above, GAT, TTT may become
          GA, TTT).

          My example for life using someone I'm sure everyone has heard me
          bitch about:  I dated this really nice girl, the most wonderful
          and best thing I've ever had in my fairly lonely and boring life.
          But I broke up with her because of reasons I even don't know, she
          was "deleted" from my life and of course everything went screwy.

        Many of you are probably thinking now, "But, mistakes can't screw up
 someone's entire life, your wrong in your comparison of DNA mutations to
 everyday life".  True, you are very sharp indeed if you thought that.  But
 alas, I'm not finished quite yet.  Sure, one mistake obviously isn't going
 to screw over your entire life like a mutation can do in a human's DNA.
 But, there is a repair 'tool' you might say that exists in DNA.  This
 veritable repair utility finds mutations and fixes them before they can
 cause any significant damage.  I'm right, and your wrong.  Whee, I love
 being in control somewhat.  I hope this made at least a small amount of
 sense, if it didn't just tell me.  I'll more than likely ignore you, but
 hey at least you tried!  Or you can always deflate my ego by sending me a
 message pointing out mistakes.  Either way, I'll write something more
 appealing to the masses next time, but for now I'm on spring break -- thank
 God -- and I feel like indulging in what I want.

 [--------------------------------------------------------------------------]
 [ (c) !LA HOE REVOLUCION PRESS!    HOE #580 - WRITTEN BY: ANILOS - 4/14/99 ]
